ارزیابی میزان تغییرات بیان ژن های خانه دار در برهمکنش گندم با بیمارگر Mycosphaerella graminicola با روش Reverse northern dot blot

نوع مقاله: علمی پژوهشی

نویسندگان

1 استادیار دانشکده کشاورزی و منابع طبیعی دانشگاه اردکان، اردکان، ایران (دانشجوی سابق دکتری بیماری شناسی گیاهی دانشکده کشاورزی دانشگاه تربیت مدرس)

2 استادیار پژوهشکده بیوتکنولوژی کشاورزی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران، ایران،

3 استاد بخش بیماری شناسی گیاهی دانشکدۀ کشاورزی دانشگاه تربیت مدرس،تهران، ایران

4 دانشیار بخش بیماریشناسی گیاهی دانشکدۀ کشاورزی دانشگاه تربیت مدرس،تهران، ایران

5 استادیار پژوهشکده بیوتکنولوژی کشاورزی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران، ایران

چکیده

به‎طور کلی ژن‌های مرجع در تجزیه و تحلیل‎های بیان ژن، از بین ژن‌های خانه‌دار انتخاب می‌شوند، اما تغییرات دیده شده در مقدار بیان مانع اساسی برای استفاده بهینه از آن‌هاست. از آنجا که بیان هیچ تک ژنی در شرایط مختلف و سلول‌های متفاوت ثابت نیست، معرفی و اعتبارسنجی ژن‌های مرجع بسیار مهم است. در این تحقیق مناسب بودن هفت ژن خانه‌دار گندم برای نرمال‌سازی بیان mRNA در برگ این گیاه در هنگام آلودگی به قارچ Mycosphaerella graminicola مطالعه شده است. به این منظور بیان ژن‌های رمزکنندۀ اکتین، روبیسکو، گلیسرآلدهید 3- فسفات دهیدروژناز ، فاکتور طویل‌سازی ترجمۀ 1 آلفا (TEF 1α)، آلفا-توبولین، فاکتورهای آزاد‎کنندۀ یوکاریوتی 1 و 3 (ERF1 و ERF3) در طول آلودگی توسط روش نوردن بلات معکوس اندازه گیری، و توسط نرم افزارهای اکسل و SAS از لحاظ آماری بررسی شد. بیان ژن‌های آلفا-توبولین، TEF 1α و اکتین از بیشترین پایداری برخوردار بود و ژن‎های روبیسکو و گلیسرآلدهید 3- فسفات دهیدروژناز کمترین ثبات بیان را داشتند. مطالعه مقایسه‌ای تغییرات در بیان ژن‌های مختلف خانه‌دار گندم در پاتوسیستم گندم - M. graminicola انتخاب ژن‌های مرجع را برای روش لکه‌گذاری نوردن‌بلات معکوس تسهیل می‌کند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Evolution of housekeeping Genes for Gene Expression in Wheat Leaves Infected by Mycosphaerella graminicola with Reverse northern dot blot

نویسندگان [English]

  • Jalal Gholamnezhad 1
  • Forogh Sanjarian 2
  • Ebrahim Mohammadi Goltapeh 3
  • Naser Safaei 4
  • Khadijeh Razavi 5
1 Assistant Professor Faculty of agriculture and natural resources, Ardakan University (Former Graduate Ph.D Student of Department of Plant pathology, Tarbiat Modarres University)
2 Assistant Professor, Agriculture Biotechnology Institute, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran
3 Professor, Department of Plant Pathology, Tarbiat Modarres University, Tehran, Iran
4 Associate Professor, Department of Plant Pathology, Tarbiat Modarres University, Tehran, Iran
5 Assistant Professor, Agriculture Biotechnology Institute, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran
چکیده [English]

As a rule the reference genes used in gene expression analysis have been selected for their housekeeping roles, but the variation observed in most of them is a major obstacle to their effective use. It is widely supported to identify and validate stable reference genes, since no single biological gene is stably expressed between cell types or within cells under different conditions. In this study, suitability of seven wheat housekeeping genes for normalization of mRNA expression in wheat leaves infected by Mycosphaerella graminicola was investigated. Expression level of Actin, Rubisco, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Translation Elongation Factor 1α (TEF-1α), α-Tubollin, eukaryotic release factors 1 and 3 (ERF1 and ERF3) genes were examined by reverse northern dot blot method. Expression stabilities of the reference genes were statistically analyzed by Ecxel and SAS softwares. α-Tubolin, TEF-1α and Actin were the three most stable genes whereas the expression of Rubisco and GAPDH had the least stability. The presented comprehensive data on changes in expression of various wheat housekeeping genes in wheat- M. graminicola phatosystem facilitate selection of reference genes for Reverse northern dot blot method.

کلیدواژه‌ها [English]

  • Gene expression analysis
  • Reference genes
  • wheat- M. graminicola
  • Reverse northern dot blot

مقدمه

از میان روش­های مختلفی که برای بررسی پروفایل بیانی ژن‎ها وجود دارد، PCR کمی زمان واقعی (Real­-time PCR)، درشت آرایه (Macroarray) و ریزآرایه (Microarray) از روش‌هایی هستند که به‎صورت گسترده در این زمینه مورد استفاه قرار می‌گیرد و این روش­ها نقش بسیار مهمی را در تحقیقات زیست شناسی دارد (Kavaousi et al., 2009). در مورد Real­-time PCR  شاخص­هایی وجود دارد که لازم است در حین انجام PCR مورد توجه و کنترل قرار گیرند. این  شاخص­ها شامل موارد مقدار اولیه نمونه­ها، غلظت RNA موجود در نمونه، کارایی ساخت cDNA، و تفاوت­ها در فعالیت نسخه‌برداری‌های کلی در بافت­ها و سلول­های مورد تجزیه و تحلیل‎ است (Chen et al., 2006). در مورد هر سه روش ذکر شده، برای به‎دست آوردن نتایج دقیق باید سطوح بیانی ژن‌های هدف به‎وسیلۀ ژن‌های کنترل داخلی، که تحت شرایط مختلف بیان ثابتی دارند و به اصطلاح ژن‌های خانه­دار یا Housekeeping نامیده می­شوند، نرمال سازی گردند. ژن‌های کنترل داخلی باید سطح بیان پایداری در بافت­های مختلف تحت تیمارهای متفاوت داشته باشند (Frericks and Esser, 2008). در طول دهه­های اخیر ژن‌های بتا- اکتین، گلیسرآلدهید 3- فسفات دهیدروژناز (GAPDH)، S18 و S26 RNA ریبوزومی، یوبیکوییتین C، آلفا-توبولین، فاکتور رونویسی 1 آلفا و پروتئین باند شونده به TATA  باکس به‎عنوان ژن‌های کنترل داخلی مناسب برای فرایند Real time PCR و همچنین  ریزآرایه ارزیابی شده­اند (Mitter et al., 2009). پیداکردن ژن‌های کنترل داخلی عمومی برای نرمال­سازی در تمامی نمونه­های مورد مطالعه کاری غیرممکن است. دلیل این امر این است که ممکن است سطوح بیانی ژن­های کنترل داخلی در بافت خاصی ثابت باشد و در بافت­های دیگر اینطور نباشد (Bustin, 2002; Bas et al., 2004; Glare et al., 2002).

برای مثال، ژن GAPDH به‎عنوان یک ژن مأخد قابل اطمینان در سلول­های غیر کشنده سرطان ریه عمل می­کند، در حالی­که ژن hypoxanthine phosphoribosyl-transferase (HPRT) دارای بیان با ثباتی در کبد است (Chen et al., 2006). مناسب بودن ژن­های کنترل داخلی جهت نرمال‌سازی به‎وسیلۀ نرم­افزارهای الگوریتمی مانند geNorm، NormFinder، Bestkeeper و General Pattern Recognition انجام می­گیرد. سپس، ژن­هایی که در رده‎بندی دارای بالاترین امتیاز باشند قبل از انجام Real time PCR انتخاب می‌شوند. گندم یکی از مهم­ترین محصولات کشاورزی در جهان است که در رژیم غذایی اکثر مردم قرار دارد (Curtis et al., 2002). گیاه گندم در طول دورۀ رشد در معرض تنش­های محیطی زنده و غیر زنده مختلفی مانند بیماری­ها و خشکی قرار می­گیرد که رشد گیاه را محدود می­کنند (Bohnert et al., 1995). یکی از بیماری­هایی که به گندم در زمان کشت خسارت زیادی در اکثر نقاط دنیا وارد می­کند بیماری سوختگی برگ گندم می­باشد (Goodwin et al., 2003). عامل این بیماری قارچ بیمارگر Mycosphaerella graminicola (Fuckel) J.Schröt.in Cohen با شکل غیرجنسی Zymoseptoria tritici است (Quaedvlieg et al., 2011). راه­های مبارزه با این بیماری متعدد هستند که از آن جمله می‌توان به‎روش­های مبارزه زراعی، شیمیایی و استفاده از ارقام مقاوم اشاره نمود؛ با توجه به عدم کارایی روش­های مبارزۀ زراعی و شیمیایی در کنترل بیماری استفاده از ارقام مقاوم اقتصادی­ترین، بهترین و از نظر زیست­محیطی، سالم‌ترین روش مقابله با این بیماری است (Eayle, 1999). دانش ژنتیک مقاومت برای اصلاح گندم مقاوم به بیماری لکه برگی گندم از اهمیت زیادی برخوردار است. مقاومت ژنتیکی در ارقام مختلف به‎دو صورت کمی و کیفی گزارش شده است (Mccartney et al., 2003). ژن­های متعددی در پاسخ گیاه به بیمارگر فعال یا خاموش می­شوند و همچنین ممکن است بیان آن­ها افزایش یا کاهش پیدا کند. بررسی بیان متمایز ژن­ها یکی از روش‌های مهم برای مشخص نمودن اساس زیستی سیستم­های بیولوژیک است (Wang et al., 2009). جهت درک مکانیسم مقاومت به بیماری سوختگی برگ گندم، لازم است که الگوی بیانی ژن­ها جهت یافتن مسیرهای حیاتی مورد بررسی قرار بگیرند، در نتیجه برای این مطالعات نیاز به ژن­های خانه­داری است که بیان ثابتی را در گندم و به‎خصوص در این پاتوسیستم داشته باشند (Tenea et al., 2011). در این مطالعه، تعداد هفت ژن منتخب خانه­دار برای این پاتوسیستم انتخاب شدند و ثبات بیان آن­ها در گندم زمانی که برگ­های آن به‎وسیلۀ بیمارگر M. graminicola تلقیح شدند با استفاده از روش Reverse northern blot  بررسی شد. در نهایت انحراف معیار بیان هر یک از ژن­ها، که با استفاده از این روش به‎دست آمدند،  با استفاده از نرم افزارهای Excel  محاسبه و با نرم­افزار SAS مورد مقایسه قرار گرفت. این هفت ژن کنترل داخلی بر اساس ثبات در میزان بیان ژن، که با استفاده از این روش کمی مورد ردیابی قرار گرفتند، رده‎بندی شدند.

 

 مواد و روش­ها

کشت گیاهان و ایجاد تنش بیمارگر

رقم گندم هگزاپلوئید متحمل زاگرس در این تحقیق مورد استفاده قرار گرفت. برای کشت گیاهان، پس از اینکه خاک گلدان­ها (محتوی پرلیت، خاک و خاکبرگ) سترون شد، با نسبت 1:1:1 مخلوط و در گلدان­های کوچک 500 گرمی ریخته شدند. بعد از آماده­سازی خاک گلدان­ها، بذور را در داخل ظرف محتوی الکل 70% به‎مدت 30 ثانیه ریخته و سپس الکل را تخلیه و دو بار با آب مقطرسترون، بذرها شسته شدند. بعد از ضدعفونی سطحی، سه بذر در داخل هر گلدان قرارداده شد و روی بذرها به ضخامت یک سانتی­متر از همان خاک ریخته شد. به‎منظور ارزیابی میزان تغییرات بیان ژن­های خانه­دار در گندم نسبت به بیمارگر
M. graminicola در شرایط گلخانه­ای، زمانی­که گیاهچه­ها به مرحلۀ دو برگی (12روزه­گی) رسیدند، سوسپانسیون قارچ بیمارگر بر روی این گیاهان اسپری شد. جهت آماده‌سازی سوسپانسیون و پاشش آن بر روی گیاه از روش Chartrain و همکاران در سال 2004 استفاده شد.

به‎منظور تهیه cDNA گیاهان در شرایط بدون تنش و تنش با بیمارگر M. graminicola، در زمان­های 0، 3، 6، 12 و 24 ساعت بعد از مایه­زنی بیمارگر، نمونه­برداری از برگ­های گیاه گندم انجام گرفت و بلافاصله برگ­ها در محل نمونه‌برداری به ظرف نیتروژن مایع منتقل و سپس در فریزر °C70- آزمایشگاه ذخیره شدند. نمونه­های شاهد که با آب مقطر مایه‌زنی شده بودند نیز به‎همین ترتیب جمع‌آوری شدند. این آزمایش در قالب طرح کاملاً تصادفی در سه تکرار انجام گرفت.

 

انتخاب ژن‌ها و تکثیر آنها

در این تحقیق از هفت ژن منتخب خانه‌دار شامل اکتین، روبیسکو، گلیسرآلدهید 3- فسفات دهیدروژناز (GAPDH)، Translation Elongation Factor1-α (TEF1α)، آلفا-توبولین، فاکتورهای آزاد‎کنندۀ یوکاریوتی 1 و 3  (ERF1 و ERF3) و همچنین ژن 18S RNA ریبوزومی جهت حذف نمودن اثر پس زمینه (Background)  استفاده شد (جدول 1). این ژن­ها بر اساس مرور منابع، همواره کمترین تغییرات را در مطالعات انجام شده بیان ژن­ها با روش­های مختلفی از جمله Real-time PCR، داشته­اند (Tenea et al., 2011; Paolacci et al., 2009; Gimenez et al., 2010). آغازگرهای اختصاصی برای هر ژن با استفاده از توالی‌های ژن‌های مورد نظر توسط نرم افزار Oligo5  طراحی شدند. پس از ساخت آغازگرهای اختصاصی (جدول1) شرایط PCR برای هر یک از جفت آغازگرهای هر ژن بهینه شد. برای انجام PCR از الگوی cDNA استفاده گردید که متعاقباً روش ساخت آن خواهد آمد. واکنش زنجیره­ای پلیمراز در شرایط دمایی ºC 95 برای واسرشت‌سازی ابتدایی به‎مدت 4 دقیقه، به دنبال آن 30 چرخه دمای ºC 94 برای 45 ثانیه،  دمای چسبیدن بسته دمای ذوب هر آغازگر به‎مدت 45 ثانیه و ºC 72 برای 45 ثانیه و در نهایت ºC 72 برای توسعۀ نهایی به‎مدت 5 دقیقه انجام شد. پس از پایان واکنش برای مشاهدۀ محصول حاصل، الکتروفورز روی ژل آگارز 5/1% در بافر 1x TAE انجام گرفت و جهت نمایان کردن قطعات DNA در ژل از رنگ آمیزی در ژل از رنگ اتیدیوم بروماید و لامپ UV استفاده شد. مقدار هر ژن از مقایسۀ میزان روشنایی باند محصول PCR با میزان روشنایی باند متناظر Ladder و کمی­کردن آن با نرم­افزار Totallab مشخص شد. از محصول PCR هر ژن 5/0 تا 1 میکروگرم جهت لکه­گذاری بر روی غشا استفاده گردید.

 

 

جدول 1. نام ژن­ها و توالی­های پرایمری مورد استفاده در نوردرن بلات معکوس

Annealing temp.

Primers (5′ - 3′)

Candidate reference genes

58 ºC

F: GCCACACTGTTCCAATCTATGA

Actin

 

R: TGATGGAATTGTATGTCGCTTC

 

64 ºC

F: GTGATGGCTTCGTCGGCTACC

RUBISCO

 

R: CTTCTTGACCTCCTCCACCTC

 

64 ºC

F: TCACTGACAAGGACAAGGCTG

GAPDH

 

R: CTGGCTTCGCAAGTCTAACAG

 

64 ºC

F: GGTGATGCTGGCATAGTGAAG

TEF-1α

 

R: GATGACACCAACAGCCACAG

 

58 ºC

F:GCTTTCAACACCTTCTTCAG

α-Tubulin

 

R:GGGGCATAGGAGGAAAGCA

 

56 ºC

F: ATTCAGTCATCACTTCAGTCG

ERF1

 

R: TCGCTCTTCCTCATTTGTGTC

 

61 ºC

F: TGGCGAGGGGCAAGCACTAC

ERF3

 

R: GGAGGAGGAGGACGAGGATG

 

58 ºC

F: CTT CGGGATCGGAGTAATGATTAA

18S rRNA

 

R: GCCCAGAACATCTAAGGGCATCACAGA

 

 

 

 ساخت پروب نشان‌دار

پس از پودر کردن بافت‌های اندام‌های هوایی در نیتروژن مایع با استفاده ازهاون چینی، استخراج RNA کل توسط کیت RNXplus شرکت سیناژن مطابق دستورالعمل انجام گرفت. در ابتدای کار، در حدود 5 میکروگرم RNA کل با مقدار 5/0 میکرولیتر آغازگر مخلوط شدند. پس از واسرشت شدن در دمای ºC 65 به‎مدت 5 دقیقه و سرد کردن این مخلوط بر روی یخ، واکنش رونویسی معکوس در حضور Thermo Scientific RiboLock RNase و Reverse Transcriptase به‎مدت 1 ساعت در دمای ºC 42 انجام گرفت. در مرحلۀ پایانی به‎منظور غیر فعال نمودن آنزیم ویال به‎مدت 10 دقیقه در دمای ºC 70 قرار گرفت و سپس به فریزر ºC20-  منتقل شد. از RNA استخراجی 5/0 میکرولیتر آغازگر Ologo (dt)18 و در حدود 5 میکروگرم RNA کل با هم مخلوط شدند. پس از واسرشت نمودن در دمای 65 به‎مدت 5 مخلوط حاصل بر روی یخ گذاشته شد. به مخلوط حاصل جهت رونوشت برداری معکوس 4 میکرولیتر بافر x5، 1 میکرولیتر ازDIG-dNTP  10 میلی­مولار، 5/0 میکرولیتر RiboLock RNase و 1 میکرولیتر Reverse Transcriptase  (هر دو از شرکت Thermo Scientific، آلمان) اضافه شد و مخلوط حاصل به‎مدت 1 ساعت در دمای ºC 42  قرار داده شد و پروب نشاندار تهیه گردید. برای تکثیر ژن­ها، جهت لکه‌گذاری بر روی غشا از cDNA ساخته شده به‎همین روش اما با dNTP معمولی، مورد استفاده قرار گرفت. برای تهیه درشت آرایه محصول PCR ژن­های انتخابی با استفاده از محلول NaOH 1 میلی­مولار و محلول 25/0 مولار NaCl واسرشت شدند و در دستگاه بلاتر 96 چاهکی بر روی غشاء لکه‌گذاری شدند. پس از خشک شدن غشاء در دمای اتاق، غشاء حاصل به‎مدت یک ساعت در دمای ºC100 قرار داده شد تا مولکول‌های cDNA بر روی آن تثبیت شوند. از محصول PCR ژن s 18 RNA  ریبوزومی گندم و از آب مقطر به‎عنوان کنترل منفی استفاده شد (Zheng et al., 2004). 

جهت واسرشت کردن، نشانگرها تهیه شده به‎مدت 5 دقیقه در آب جوش و به‎دنبال آن 5 دقیقۀ دیگر بر روی یخ قرار داده شدند. پیش دورگه‌سازی غشا با 50 میلی­لیتر از محلول پیش دورگ‌سازی با 2/7 pH= (35 میلی­لیتر SDS 7%، 100 میکرولیتر EDTA 1 میلی‌مولار و 5/12 میلی­لیتر بافر فسفات 25/0 مولار) در دمای ºC 65 به‎مدت 5/1 ساعت انجام شد. در مرحلۀ بعد 50 میکرولیتر نشانگر واسرشته به 5 میلی­لیتر محلول پیش هیبریداسیون اضافه گردید و دورگ سازی به‎مدت یک شب در دمای ºC65 انجام شد. بعد از دورگ‌سازی، غشاء سه مرتبه شستشو داده شد. شستشوی اول غشاء با محلول X2 SSC حاوی 1/0 درصد SDS دو مرتبه به‎مدت 15 دقیقه در دمای اتاق، شستشوی دوم غشا با محلول X5/0 SSC حاوی 1/0 درصد از SDS یک بار به‎مدت 15 دقیقه در دمای °C65 و شستشوی آخر غشاء با محلول X2/0 SSC بدون SDS به‎مدت 15 دقیقه در دمای اتاق انجام شد. در مرحلۀ آخر 10 میکرولیتر سوبسترای CDS-Star به غشا اضافه گردید. سپس غشا به تاریک خانه بوده و در معرض فیلم رادیولوژی (X-ray) گذاشته شد و بعد از 30 دقیقه فیلم ظاهر گردید. امتیازدهی به لکه‌ها با استفاده از نرم افزار TotalLab صورت گرفت که میزان تیرگی لکه­ها را براساس تعداد نقاط تیره موجود در محدوده لکه مورد نظر مشخص می‌کند. در مرحلۀ آخر پردازش داده­های غشا و قبل از ورود داده­ها به نرم‌افزارهای آماری جهت حذف نمودن اثر پس زمینه (Back ground) همۀ داده­ها بر s 18 RNA  ریبوزومی ­تقسیم شدند و سپس داده­های حاصل از نرم‌افزار TotalLab وارد نرم­افزار Excel شدند.

 

تجزیه و تحلیل‎های آماری

سطوح بیانی ژن­ها، که در واقع تیرگی لکه­ها است، به‎صورت کمی از نرم­افزار TotalLab خروجی گرفته می­شود. برای محاسبۀ تغییرات بیان ژن در طول زمان داده­های حاصله وارد Excel شدند، برای هر کدام از این 7 ژن، در طول 24 ساعت نمودار خطی (میانگین چهار تکرار) رسم شد و میزان نوسان این ژن‌ها با شاخص انحراف معیار اندازه­گیری شد و سپس میانگین انحراف معیار مربوط به هر ژن با استفاده از آزمون چند دامنه­ای دانکن در سطح اطمینان به‎وسیلۀ نرم افزار SAS ver.9 مورد مقایسه قرار گرفت.

 

نتایج و بحث

هدف اصلی از نرمال­سازی بیان ژن­ها کم­کردن اختلاف بین نمونه­های آزمایشی است، که این اختلافات ناشی از تفاوت در روش آزمایش، تفاوت در آماده­سازی نمونه­ها، کیفیت RNA کل، سنتز cDNA و راندمان تکثیر ژن‌های هدف می­باشد. ژن­هایی که برای فرایند نرمال‌سازی مورد استفاده قرار می­گیرند ژن­های مرجع نامیده می­شوند و غالباً تغییراتی در سطوح بیانی آن­ها در طول آزمایش اتفاق نمی­افتد (Galiventi et al., 2010). تحقیقات زیادی در مورد معرفی ژن مرجع در گندم جهت استفاده در روش Real time PCR صورت گرفته است، اما تاکنون مطالعات سیستماتیکی در مورد فرایند نرمال سازی ژن­ها با استفاده از روش نوردرن بلات معکوس انجام نشده است ، مطالعه حاضر اولین تحقیق در مورد ژن­های مرجع با این روش در پاتوسیستم مذکور است. در این مطالعه هفت ژن (جدول1) جهت انتخاب بهترین ژن­های مرجع در پاتوسیستم گندم - M. graminicola مورد بررسی قرار گرفتند. بر اساس اطلاعات به‎دست آمده از غشاء  (برای مثال شکل 3 لکه‌ها مربوط به ژن اکتین) میزان بیان ژن­های خانه­دار در دورۀ 24 ساعت نمونه‌برداری به‎صورت متفاوتی تغییر پیدا کرد (نمودارهای 1، A-G). مقادیر میزان پایداری بیان ژن­­های خانه­دار با استفاده مقایسۀ انحراف معیار داده‌های مربوط به هر ژن خانه­دار در طی زمان 24 ساعت مشخص شد. به این ترتیب که هر چه انحراف معیار کمتر باشد در نتیجه پراکندگی داده­ها کمتر و داده­ها از پایداری بیشتری در طی زمان نمونه‌برداری برخوردار بوده‌اند. ثبات بیان بالای ژن آلفا-توبولین، نشان­دهندۀ آن است که می­توان از آن به‎عنوان یک ژن کنترل داخلی مناسب استفاده شود.

 

 

 

B

 

A

 

D

 

C

 

F

 

E

 G

شکل1. تغییر بیان ژن­های خانه‌دار در روش نوردرن بلات معکوس.  زمان نمونه برداری 0، 3، 6، 12 و 24 ساعت بعد از تلقیح بیمارگر و شاهد تلقیح شده با آب، t: زمان نمونه برداری به ساعت. +NP: تیمار بدون بیمارگر، +P: تیمار با وجود بیمارگر. نمودارها کمیت مربوط به تیرگی ژن­ها نسبت به لکۀ 18SrRNA در هر بلات را نشان می­دهد که با استفاده از نرم افزار TotalLab به‎دست آمده است. A: اکتین، B: روبیسکو، C: گلیسرآلدهید 3- فسفات دهیدروژناز، D: TEF 1α، E: آلفاتوبولین، F: فاکتورهای آزاد‎کنندۀ یوکاریوتی1 (ERF1) G: فاکتورهای آزاد‎کنندۀ یوکاریوتی 3 (ERF3)

 

 

 

 

 

 

جهت ارزیابی پایداری در سطوح بیانی این هفت ژن، انحراف معیار سطوح بیانی این ژن­ها محاسبه شد و سپس با استفاده از نرم­افزار آماری SAS 9، مورد مقایسه قرار گرفتند. در شکل 2 انحراف معیار هر یک  از این ژن­ها نشان داده شده است، انحراف معیار کمتر نشان­دهندۀ پایداری بیشتر ژن مذکور در طی فرایند آزمایش است.

 

بر اساس نتایج این مطالعه، ژن­های آلفا-توبولین، TEF-1α و اکتین پایدارترین ژن‌ها جهت استفاده به‎عنوان ژن‌های کنترل داخلی بودند، و ژن ERF1 چهارمین ژن پایدار در این تحقیق بود. بر اساس نمودار 2 ژن روبیسکو و GAPDH کمترین پایداری را در بین ژن‌های بررسی شده در این تحقیق با استفاده از روش نوردرن‌بلات معکوس داشتند.

 

 

شکل 2.  انحراف معیار بیان ژن­های خانه­دار، مقدار عددی بیشتری نشان­دهندۀ پایداری کمتر در بیان ژن است. انحراف معیارهایی که با حروف مختلف نشان داده ­شده­اند در آزمون دانکن (05/0P≤) دارای اختلاف معنی‌دار می­باشند.

 

 

شکل 3. عکس­ از درشت آرایه­های تهیه شده از بیان ژن خانه دار اکتین، 0SA+NP: گیاه گندم تحت تیمار آب مقطر و عدم وجود بیمارگر، 0SA+P: گیاه گندم تحت تیمار آب مقطر و بیمارگر ، 2SA+NP: گیاه گندم تحت تیمار غلظت 2 میلی­مولار اسیدسالیسیلیک و عدم وجود بیمارگر، 0SA+P: گیاه گندم تحت تیمار غلظت 2 میلی­مولار اسیدسالیسیلیک و بیمارگر؛ نقاط زمانی شامل ساعت 0، 3، 6، 12 و 24 ساعت بعد از نمونه­برداری است.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

در مطالعه­ای که با استفاده از روش Real time PCR انجام گرفت، ثبات بیان ژن­های خانه­دار اکتین (Ta54825)، آلفا-توبولین (Ta25534)، بتاتوبولین (Ta44405)، یوبیکوئیتین (Ta50503)، GAPDH (Ta30768)،Translation elongation factor (Ta53964)،Translation initiation factor  (Ta54280)، Ribosomal protein (Ta27771) و هیستون (Ta38797) در گندم بررسی شد. نتایج این تحقیق که با استفاده از الگوریتم­های ریاضی geNorm و NormFinder انجام گرفت نشان داد که همگی این ژن‌ها از سطح بیان قابل قبولی در ارقام مختلف گندم برخوردار بودند و می­توانند به‎عنوان ژن خانه­دار انتخاب شوند (Paolacci et al., 2009). با بررسی سه ژن ACT2 (actin 2)، TaFNRII (ferredoxin-NADP(H) oxidoreductase، و rrn26 ( a putative Homologuse to RNA 26S gene) که به‎عنوان ژن‌های مرجع شناخته شده‌اند و دو ژن دیگر YP18-2 (Cyclophilin A و TaWIN1 (14-3-3 like protein) در گندم­های زمستانه تحت تنش نیترات، ژن­هایTaFNRII, ACT2  و CYP18-2 به‎عنوان ژن­های مرجع در این سیستم پیشنهاد شده‌اند (Tenea et al., 2011). مطالعه جهت تعیین بهترین ژن مرجع در دوره نمو گیاه چای مشخص شد که ژن‌های  GAPDHو بتا توبولین بدترین انتخاب‌ها وژن TATA-box binding protein  بهترین انتخاب در این سیستم از میان نه ژن مورد بررسی، هستند  (Wu, Z.-J. et al., 2016). گرچه از ژن GAPDH در مطالعات زیادی به‎عنوان ژن مرجع استفاده شده است، اما در مطالعه حاضر الگوی بیانی ثابتی را نشان نمی‌داد. مطالعات دیگری نیز عدم ثبات بیانی این ژن را نشان داده‌اند (Wu, Z.-J. et al., 2016; Yang et al., 2016). با توجه به اینگونه مطالعات، تعداد بهینه ژن­ مرجع برای نرمال سازی در هر پژوهش، دو تا سه ژن است که با توجه به‎تعداد نمونه­ها و روش مورد استفاده، متفاوت خواهد بود. در اغلب مواقع، استفاده از حداکثر سه ژن مرجع حدقابل قبولی از نرمال سازی را به وجود می­آورد­­­ (Gime´nez et al., 2010). مطالعات زیادی نشان دادند که بیان ژن­های خانه­دار در طی ایجاد تنش در شرایط مختلف می­تواند به‎طور چشم­گیری تغییر پیدا کند و در نتیجه تأثیر زیادی هم بر روی نتایج نهایی می­گذارد (Bustin, 2000). علاوه بر شاخص­های زیستی، محدودیت­های آزمایشگاهی و عوامل اقتصادی در انتخاب  تعداد مطلوب ژن­های کنترل داخلی دخالت دارند (Lopez-Landavery et al., 2014). ریزآرایه و  Real time PCR از روش­های مرسوم در کمی­سازی بیان ژن هستند  (Kavaousi et al., 2009). استفاده از روش ریزآرایه احتیاج به تجهیزات خاص دارد که ممکن است در دسترس همگان نباشد. با روش Real time PCR نیز در هر آزمایش تعداد معدودی ژن را می­توان بررسی کرد. درشت آرایه نیز یکی از ابزارهای قدرتمند بررسی بیان ژن است که امکان بررسی همزمان تعداد قابل توجهی ژن را با تجهیزات معمول آزمایشگاه می­دهد (Ji et al, 2003). مطالعه حاضر ژن­های مرجع مناسب برای استفاده در این روش ارایه داده که در برهمکنش گندم و قارچ M. graminicola کارآمد بوده و در مطالعات آتی مورد استفاده قرار خواهند گرفت.

 

سپاسگزاری

از پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری (طرح 451م) و همچنین دانشگاه تربیت مدرس برای فراهم آوردن امکانات این پژوهش تشکر و قدردانی می­گردد.  

Bas AG, Forsberg S, Hammarstrom ML (2004) Utility of the housekeeping genes 18S rRNA, β-Actin and Glyceraldehyde-3-Phosphate-Dehydrogenase for normalization in real-time quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scand. J. Immunol. 59: 566-573.

Bohnert HJ, Nelson DE, Jensen RG (1995) Adaptation to environmental stresses. Plant Cell. 7: 1099-1111.

Bustin SA (2000) Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25: 169-193.

Chartrain L, Brading P, Makepeace J, Brown J (2004) Sources of resistance to Septoria tritici blotch and implications for wheat breeding. Plant Pathol. 53: 454-460.

Chen J, Rider DA, Ruan R, (2006) Identification of valid housekeeping genes and antioxidant enzyme gene expression change in the aging rat liver. J. Gerontol. A Biol. Sci. Med. Sci. 61: 20-27.

Curtis BC, Rajaram S, Gomez Macpherson H, (2002) Bread wheat. Improvement production. FAO, Rome.

Eyal Z, (1999) Breeding for resistance to Septoria and Stagonospora diseases of wheat.In Septoria on Cereals: A Study of Pathosystems. JA Lucas, P. Bowyer, and AM Anderson, eds .CAB International, Wallingford, UK: 115-130.

Frericks M, Esser C, (2008) A toolbox of novel murine house-keeping genes identified by meta-analysis of large scale gene expression profiles. Biochim. Biophys. Acta Gene Regul. Mech. 1779: 830-837.

Galiventi C, Rozhdestvensky R, Brosius RT, Lehrach H, Konthur Z (2010) Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. METHOD. 16(2): 450-461.

Gimenez MJ, Fernando P, Atienza SG (2010) Identification of suitable reference genes for normalization of qPCR data in comparative transcriptomics analyses in the Triticeae. Planta, DOI 10.1007/s00425-010-1290-y.

Glare E, Divjak M, Baile M, Walters E (2002) β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalizing mRNA levels. Thorax, 57: 765-770.

Goodwin SB (2007) Back to basics and beyond: increasing the level of resistance to Septoria tritici blotch in wheat. Australasian Plant Pathol. 36: 532-538.

Kavousim HR, Marashi H, Mozafari J, Bagheri AR (2009) Expression of phenylpropanoid pathway genes in chickpea defense against race 3 of Ascochyta rabiei. Plant Pathol. J., 8: 127-132.

López-Landavery, EA, Portillo-López A, Gallardo-Escárate C, Del Río-Portilla MA (2014) Selection of reference genes as internal controls for gene expression in tissues of red abalone Haliotis rufescens (Mollusca, Vetigastropoda; Swainson, 1822). Gene 549: 258–26

Mccartney C, Brute-Babel A, Lamari L, Somers D (2003) Chromosomal location of a race-specific resistance gene to Mycosphaerella graminicola in the spring wheat ST6. Theor. Appl Genet. 107: 1181- 1186.

Mitter K, Kotoulas G, Magoulas A, Mulero V, Sepulcre P et al., (2009) Evaluation of candidate reference genes for QPCR during ontogenesis and of immune-relevant tissues of European seabass (Dicentrarchus labrax). Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 153: 340-347.

Paolacci AR, Tanzarella OA, Porceddu E, Ciaffi M (2009 Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Molecul. Biol. 10(11): 1-27.

Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, Razavi M, Gohari AM, Mehrabi R (2011) Zymoseptoria gen. Nov.: A new genus to accommodate Septoria-like species occurring on graminicolous hosts. Persoonia – Molecul. Phyl and Evol. Fungi. 26: 57-69.

Tenea GN, Bota AP, Raposo F, Maquet C (2011) Reference genes for gene expression studies in wheat flag leaves grown under different farming conditions. BMC. 4:373-385.

Wang X, Tang C, Zhang G, Li Y, Wang C, Liu BZ, Zhao J, Han Q, Huang L (2009) cDNA-AFLP analysis reveals differential gene expression in compatible interaction of wheat challenged with Puccinia striifonnis f. sp. tritici. BMC 10: 289-304.

Wu, ZJ, Tian Ch, Jiang Q, Li X-H, Zhuang (2016) Selection of suitable reference genes for qRT-PCR normalization during leaf development and hormonal stimuli in tea plant (Camellia sinensis). Sci. Rep. 6, 19748; doi: 10.1038/srep19748.

Yang Y, Zhang X, Chen Y, Guo J, Ling H, Gao S, Su Y, Que Y and Xu L (2016) Selection of Reference Genes for Normalization of MicroRNA Expression by RT-qPCR in Sugarcane Buds under Cold Stress. Front. Plant Sci. 7:86. doi: 10.3389/fpls.2016.00086

Zheng J, Zhao J, Tao Y, Wang J, Liu Y, Fu J, Jin Y, Gao P, Zhang J, Bai Y, Wang G (2004) Isolation and analysis of water stress induced genes in maize seedlings by subtractive PCR and cDNA macroarray. Plant Molecul. Biol. 55: 807-823.